Skip to Content
Merck
All Photos(1)

Key Documents

EHU041881

Sigma-Aldrich

MISSION® esiRNA

targeting human SNCG

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACACCCACCATGGATGTCTTCAAGAAGGGCTTCTCCATCGCCAAGGAGGGCGTGGTGGGTGCGGTGGAAAAGACCAAGCAGGGGGTGACGGAAGCAGCTGAGAAGACCAAGGAGGGGGTCATGTATGTGGGAGCCAAGACCAAGGAGAATGTTGTACAGAGCGTGACCTCAGTGGCCGAGAAGACCAAGGAGCAGGCCAACGCCGTGAGCGAGGCTGTGGTGAGCAGCGTCAACACTGTGGCCACCAAGACCGTGGAGGAGGCGGAGAACATCGCGGTCACCTCCGGGGTGGTGCGCAAGGAGGACTTGAGGCCATCTGCCCCCCAACAGGAGGGTGAGGCATCCAAAGAGAAAGAGGAAGTGGCAGAGGAGGCCCAGAGTGGGGGAGACTAGAGGGCTACAGGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Changru Fan et al.
Cytogenetic and genome research, 154(4), 209-216 (2018-06-15)
The aim of the study was to evaluate the effects of synuclein-γ (SNCG) silencing on gastric cancer SGC7901 cells and to elucidate the associated mechanisms. pGCSIL-lentiviral siRNA targeting of the SNCG gene was employed to inhibit SNCG expression. Several experiments
Jingsong He et al.
Journal of breast cancer, 17(3), 200-206 (2014-10-17)
Synuclein-γ (SNCG), which was initially identified as breast cancer specific gene 1, is highly expressed in advanced breast cancers, but not in normal or benign breast tissue. This study aimed to evaluate the effects of SNCG siRNA-treatment on breast cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service