Skip to Content
Merck
All Photos(1)

Key Documents

EMU067171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xrcc6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCAAGCAAGCTGGAAGACCTGCTAAGGAAGGTTCGAGCCAAGGAGACCAAAAAGCGAGTTCTGTCCAGGTTAAAGTTTAAGCTCGGTGAAGACGTAGTACTCATGGTGGGCATTTATAACTTGGTCCAGAAAGCTAACAAGCCTTTTCCAGTGAGACTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACAAGGACTTTTAATGTAAACACCGGCAGTCTACTCCTGCCTAGTGACACCAAGCGGTCTCTGACTTACGGGACACGTCAGATTGTGCTGGAGAAAGAGGAGACAGAGGAGCTGAAGCGGTTTGATGAGCCAGGTTTGATCCTCATGGGCTTTAAGCCCACGGTGATGCTGAAGAAGCAGCACTACCTGAGGCCCTCTCTGTTCGTGTACCCAGAGGAGTCCCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Bahityar Rahmutulla et al.
Oncotarget, 5(9), 2404-2417 (2014-05-09)
The far-upstream element-binding protein-interacting repressor (FIR) is a c-myc transcriptional suppressor. FIR is alternatively spliced to lack the transcriptional repression domain within exon 2 (FIRΔexon2) in colorectal cancers. FIR and FIRΔexon2 form homo- or heterodimers that complex with SAP155. SAP155
Jin Meng et al.
Molecular medicine reports, 12(1), 581-586 (2015-02-20)
It was previously reported that the histone deacetylase inhibitor (HDACI) trichostatin A (TSA) induced B cell lymphoma 2 (Bcl-2)-associated X protein (Bax)-dependent apoptosis in colorectal cancer (CRC) cells. In addition, Ku70 has been identified as a regulator of apoptosis, the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service