Skip to Content
Merck
All Photos(1)

Key Documents

EHU052581

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM1B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGATGGAACTGGATGAGCTCTATGAGTTTCCAGAGTATTCCCGAGACCCCACCATGTACCTGGCTTTGAGAAACCTCATCCTCGCACTGTGGTATACTAACTGCAAAGAAGCTCTTACTCCTCAGAAATGTATTCCTCACATCATCGTCCGGGGTCTCGTGCGTATTCGATGCGTTCAGGAAGTGGAGAGAATACTGTATTTTATGACCAGAAAAGGTCTCATCAACACTGGAGTTCTCAGCGTGGGAGCCGACCAGTATCTTCTCCCTAAGGACTACCACAATAAATCAGTCATCATTATCGGGGCTGGTCCAGCAGGATTAGCAGCTGCTAGGCAACTGCATAACTTTGGAATTAAGGTGACTGTCCTGGAAGCCAAAGACAGAATTGGAGGCCGAGTCTGGGATGATAAATCTTTTAAAGGCGTCACAGTGGGAAGAGGAGCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Aman Kumar et al.
Molecular biology reports, 47(9), 7273-7276 (2020-08-06)
NLRP3 pathway plays a vital role in the pathogenesis of different human cancers but still the regulation of NLRP3 pathway largely unknown. Therefore, we examined the levels of NLRP3 and its downstream components (caspase-1 and IL-1β) and its relationship with
Aman Kumar et al.
Scientific reports, 9(1), 8189-8189 (2019-06-05)
Renal cell carcinoma (RCC) is the leading cause among cancer-related deaths due to urological cancers, which results in response to combination of genetic and epigenetic factors. Histone methylations have been implicated in renal tumorigenesis but their clinical significance and underlying

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service