Skip to Content
Merck
All Photos(1)

Key Documents

EHU033981

Sigma-Aldrich

MISSION® esiRNA

targeting human COPB2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACAGGAGCGGATGACATGCAGATTAGAGTGTTCAATTACAATACTCTGGAGAGAGTTCATATGTTTGAAGCACACTCAGACTACATTCGCTGTATTGCTGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eleni G Christodoulou et al.
Oncotarget, 8(21), 34283-34297 (2017-04-19)
Mutated KRAS plays an important role in many cancers. Although targeting KRAS directly is difficult, indirect inactivation via synthetic lethal partners (SLPs) is promising. Yet to date, there are no SLPs from high-throughput RNAi screening, which are supported by multiple
Rene Raphemot et al.
Cell chemical biology, 26(9), 1253-1262 (2019-07-02)
Plasmodium parasites undergo an obligatory and asymptomatic developmental stage within the liver before infecting red blood cells to cause malaria. The hijacked host pathways critical to parasite infection during this hepatic phase remain poorly understood. Here, we implemented a forward

Protocols

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service