Skip to Content
Merck
All Photos(1)

Key Documents

EHU031131

Sigma-Aldrich

MISSION® esiRNA

targeting human SUB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAGCTCTTCTGGCAGTGATTCTGACAGTGAGGTTGACAAAAAGTTAAAGAGGAAAAAGCAAGTTGCTCCAGAAAAACCTGTAAAGAAACAAAAGACAGGTGAGACTTCGAGAGCCCTGTCATCTTCTAAACAGAGCAGCAGCAGCAGAGATGATAACATGTTTCAGATTGGGAAAATGAGGTACGTTAGTGTTCGCGATTTTAAAGGCAAAGTGCTAATTGATATTAGAGAATATTGGATGGATCCTGAAGGTGAAATGAAACCAGGAAGAAAAGGTATTTCTTTAAATCCAGAACAATGGAGCCAGCTGAAGGAACAGATTTCTGACATTGATGATGCAGTAAGAAAACTGTAAAATTCGAGCCATATAAATAAAACCTGTACTGTTCTAGTTGTTTTAATCTGTCTTTTTACATTGGCTTTTGTTTTCTAAATGTTCTCCAAGCTATTGTATGTTTGGATTGCAGAAGAATTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

B V S K Chakravarthi et al.
Oncogene, 35(49), 6330-6340 (2016-06-09)
MicroRNA-101, a tumor suppressor microRNA (miR), is often downregulated in cancer and is known to target multiple oncogenes. Some of the genes that are negatively regulated by miR-101 expression include histone methyltransferase EZH2 (enhancer of zeste homolog 2), COX2 (cyclooxygenase-2)
Shaolin Tao et al.
American journal of cancer research, 5(6), 1878-1889 (2015-08-14)
Human transcriptional positive cofactor 4 (PC4) is a novel marker for diagnosis and treatment of advanced human cancers metastasis. In human lung adenocarcinoma, tumor lymphangiogenesis, an important early event, can promotes lymphatic metastasis, while it has been reported that VEGF-C/VEGF-D/VEGFR-3
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service