Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU202811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptprc

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAAATACTATGAAGTGTCCCTACTTGCCTATGTCAATGGGAAGATTCAAAGAAATGGGACTGCTGAGAAGTGCAATTTTCACACAAAAGCAGATCGTCCGGACAAGGTCAATGGAATGAAAACCTCCCGGCCGACAGACAATAGTATAAATGTTACATGTGGTCCTCCTTATGAAACTAATGGCCCTAAAACCTTTTACATTTTGGTAGTCAGAAGTGGAGGTTCTTTTGTTACAAAATACAACAAGACAAACTGTCAGTTTTATGTAGATAATCTCTACTATTCAACTGACTATGAGTTTCTGGTCTCTTTTCACAATGGAGTGTACGAGGGAGATTCAGTTATAAGAAATGAGTCAACAAATTTTAATGCTAAAGCACTGATTATATTCCTGGTGTTTCTGATTATTGTGACATCAATAGCCTTGCTTGTTGTTTTGTATAAAATCTATGATCTGCGCAAGAAAAGATCCAGCAATTTAGATGAACAACAGGAACTCGTTGAAAGGGA

Ensembl | nº de acceso | ratón

ENSMUSG00000026395

Nº de acceso NCBI

NM_011210

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PTPRC(19264) , Ptprc(19264)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Iwona Grabowska et al.
Journal of muscle research and cell motility, 36(6), 395-404 (2015-11-29)
The skeletal muscle injury triggers the inflammatory response which is crucial for damaged muscle fiber degradation and satellite cell activation. Immunodeficient mice are often used as a model to study the myogenic potential of transplanted human stem cells. Therefore, it
Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.
Xu Chang Geng et al.
Molecular medicine reports, 11(5), 3860-3865 (2015-01-13)
Erythropoietin (EPO) is a hematopoietic hormone that protects against renal interstitial fibrosis in animal models; however, the mechanism underlying the anti‑fibrotic activity of EPO has remained elusive. The present study aimed to elucidate this mechanism. Twenty‑four male C57BL6 mice were
Kunitoshi Kobayashi et al.
International immunology, 27(7), 333-344 (2015-02-28)
Dimethyl fumarate (DMF) is a modifier of the nuclear factor (erythroid-derived 2)-2 (Nrf2)-kelch-like ECH-associated protein 1 (Keap1) pathway. DMF treatment in the effector phase significantly suppressed the development of Theiler's murine encephalomyelitis virus-induced demyelinating disease (TMEV-IDD) both clinically and histologically.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico