Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU201661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nell1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGAACTGGAGAGCAGTGGCCCAAGAGAAGAGATACGCTATCATTACATCCATGGCGGCAAGCCCAGGACTGAGGCCCTTCCCTACCGCATGGCCGATGGACAGTGGCACAAGGTCGCGCTGTCTGTGAGCGCCTCTCACCTCCTACTCCATGTCGACTGCAATAGGATTTATGAGCGTGTGATAGATCCTCCGGAGACCAACCTTCCTCCAGGAAGCAATCTATGGCTTGGGCAACGTAATCAAAAGCATGGCTTTTTCAAAGGAATCATCCAAGATGGCAAGATCATCTTCATGCCGAACGGCTTCATCACACAGTGCCCCAACCTAAATCGCACTTGCCCAACATGCAGTGATTTCCTGAGCCTGGTTCAAGGAATAATGGATTTGCAAGAGCTTTTGGCCAAGATGA

Ensembl | nº de acceso | ratón

ENSMUSG00000055409

Nº de acceso NCBI

NM_001037906

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NELL1(338352) , Nell1(338352)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Claudio Raimondi et al.
The Journal of experimental medicine, 211(6), 1167-1183 (2014-05-28)
To enable new blood vessel growth, endothelial cells (ECs) express neuropilin 1 (NRP1), and NRP1 associates with the receptor tyrosine kinase VEGFR2 after binding the vascular endothelial growth factor A (VEGF) to enhance arteriogenesis. We report that NRP1 contributes to
Hong-Bo Pang et al.
Nature communications, 5, 4904-4904 (2014-10-04)
Neuropilins (NRPs) are trans-membrane receptors involved in axon guidance and vascular development. Many growth factors and other signalling molecules bind to NRPs through a carboxy (C)-terminal, basic sequence motif (C-end Rule or CendR motif). Peptides with this motif (CendR peptides)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico