Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU198551

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Arf1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCACCTGCATTCCATAGCATTGTGCTTGTACTTGTGCTCACACGGTTACCTAGGGTAGGCTGGGAGCCATTGTGGGGTGCAGGGCCTGGCTTGTACTTGGTGTGTGCAAGGCCCAATGGCAGCCTGCATACCCAGCCTACTCTTGGGCCCACTTGGACGCGCTGGCAGGAGGCCTGGGTCTCACCAGCAGGAGTGCGTGCAAGGTGGGAGGGTCGGTCCATTACAGACCCACATCCTGGAGCACCCCCATCTCCATGTGTGAAGTAGCTTCCTCCCTCAGCCTGCAAGGGTCCGATTTGCCATCGAAAGACGACCTCTACTTTTTTCTTTTGTATTTTGATAAACACTGAAGAAGCTGGAGCTGTTAAATTTATCTTGGGGAAATCTCAGAACTGGTTTATTTGGTGTCGTGGAACCTCTTACCGCTTTCAATACACAATTAGTAATCAACTGTTTTGTATACTTGTTTTCAGTTTTCATTTCGACAAGCACTGTAATTATAGCTGTTA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde
Christin Münzberg et al.
Journal of cellular and molecular medicine, 19(5), 948-959 (2015-03-11)
Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico