Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU196041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Plg

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACCACAGCAAAGAGCAGCAATGCGTGATCATGGCGGAGAACAGCAAGACTTCCTCCATCATCCGGATGAGAGACGTCATCTTATTCGAAAAGAGAGTGTATCTGTCAGAATGTAAGACCGGCATCGGCAACGGCTACAGAGGAACCATGTCCAGGACAAAGAGTGGTGTTGCCTGTCAAAAGTGGGGTGCCACGTTCCCCCACGTACCCAACTACTCTCCCAGTACACATCCCAATGAGGGACTAGAAGAGAACTACTGTAGGAACCCAGACAATGATGAACAAGGGCCTTGGTGCTACACTACAGATCCGGACAAGAGATATGACTACTGCAACATTCCTGAATGTGAAGAGGAATGCATGTACTGCAGTGGAGAAAAGTATGAGGGCAAAATCTCCAAGACCATGTCTGGACTTGACTGCCAGGCCTGGGATTCTCAGAGCCCACATGCTCATGGATACATCCCTGCCAAATTTCCAAGCAAGAACCTGAAGATGAATTATTGCCGCAACC

Ensembl | nº de acceso | ratón

ENSMUSG00000059481

Nº de acceso NCBI

NM_008877

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PLG(18815) , Plg(18815)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
Karen A Newell-Litwa et al.
The Journal of cell biology, 210(2), 225-242 (2015-07-15)
RhoGTPases organize the actin cytoskeleton to generate diverse polarities, from front-back polarity in migrating cells to dendritic spine morphology in neurons. For example, RhoA through its effector kinase, RhoA kinase (ROCK), activates myosin II to form actomyosin filament bundles and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico