Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU193121

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Duox1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCTGTGCCTTAACCCAGTACTCATTTCTGGCCACCTCAGCCTTGGCCCTTCCCACCTGCCAACTTGGTTGGTCCAAGTAGCCTCGCTCAGGCATCATGTGTAGGCTCAGAGATCTCTAGGGCCAGAATGTGTCTTGAGTTTGTCGAAGGAGCACTGTTTAAGAACTATAGGTTCAGAAGTAGGGGAGCTTTTGGGTTGAGACAAAGTGAGAATTAAGCAAAAACTTGACAGTAGACAACCTGTCAAGTTTTTGAAAGTGAGTCTGAGTGATAGTATGGATGCTGGCGTCTTCAAGTCCTCTTCACTGTGTTCTTCCTCTCTTCAAAATGGTTGGGAGATGTCTTAGAGTAGCCAGGGGCAACTTACAGAAACCCTCAGGACCAGCCTAACTGAACAACTGATCTCTCAAAATGTAAAATGTAGTCAGACCTTTCTGTGCCCACTAACCGCCTGGAGCAGTGCCCCTCAGCCCCATCTCCCTCTTCTAGTGGTCTGTTTTGCAAATAAACGGTGTTTCCC

Ensembl | nº de acceso | ratón

ENSMUSG00000033268

Nº de acceso NCBI

NM_001099297

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... DUOX1(99439) , Duox1(99439)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rabii Ameziane-El-Hassani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5051-5056 (2015-04-08)
Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have
Zhimin Feng et al.
Infection and immunity, 82(11), 4458-4465 (2014-08-13)
Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico