Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU191511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAGCAGCTCTCCAGGGTCAGGTCCCAGTTCACCAAACAATGGCCCTGCTGGGAATGTGACCGAAAATGAGGCTTCAGCTCTGCCTCCCACGCCTCACCCCGAGCAACTGGTTCCACAGCAGCGCATACTAATTCATGAAGATTCCATGAACCTGCTAAGTCTCTATACCTCCCCGTCCCTGCCCAATATCACTCTGGGACTTCCAGCAGTGCCGTCCCCACTCAATGCTTCTAACTCACTCAAAGACAAACAGAAGTGCGAGACACAGATGCTCAGACAAGGTGTTCCTCTGCCCAGTCAGTATGGCAGTAGCATTGCAGCGTCCTCCAGCCACGTTCATGTAGCAATGGAAGGAAAACCCACCAGCAGCCACCAGGCTCTCCTGCAGCACCTACTGCTGAAGGAACAAATGCGACAGCAAAAGCTTCTCGTGGCTGGTGGAGTTCCATTACACCCTCAGTCTCCTTTGGCAACAAAAGAAAGAATTTCACCAGGCATTAGAGGTACCCACAAATTGCC

Ensembl | nº de acceso | ratón

ENSMUSG00000004698

Nº de acceso NCBI

NM_024124

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... HDAC9(79221) , Hdac9(79221)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dong-Qin Chen et al.
Oncotarget, 5(10), 3333-3349 (2014-05-17)
Chemoresistance is one of the most significant obstacles in lung adenocarcinoma (LAD) treatment, and this process involves genetic and epigenetic dysregulation of chemoresistance-related genes. Previously, we have shown that restoration of microRNA (miR)-200b significantly reverses chemoresistance of human LAD cells
Rui Yang et al.
Oncotarget, 6(10), 7644-7656 (2015-03-12)
Histone deacetylase 9 (HDAC9), a member of class II HDACs, regulates a wide variety of normal and abnormal physiological functions. We found that HDAC9 is over-expressed in prognostically poor glioblastoma patients. Knockdown HDAC9 decreased proliferation in vitro and tumor formation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico