Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU187301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ldha

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTCAAAAGATTCAAAGTCCAAGATGGCAACCCTCAAGGACCAGCTGATTGTGAATCTTCTTAAGGAAGAGCAGGCTCCCCAGAACAAGATTACAGTTGTTGGGGTTGGTGCTGTTGGCATGGCTTGTGCCATCAGTATCTTAATGAAGGACTTGGCGGATGAGCTTGCCCTTGTTGACGTCATGGAAGACAAACTCAAGGGCGAGATGATGGATCTCCAGCATGGCAGCCTCTTCCTTAAAACACCAAAAATTGTCTCCAGCAAAGACTACTGTGTAACTGCGAACTCCAAGCTGGTCATTATCACCGC

Ensembl | nº de acceso | ratón

ENSMUSG00000063229

Nº de acceso NCBI

NM_010699

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... LDHA(16828) , Ldha(16828)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
KWU
DWS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guojun Hua et al.
Oncology reports, 31(6), 2727-2734 (2014-05-03)
Chondrosarcoma is a malignant cartilage-forming cancer composed of cells derived from transformed cells that produce cartilage. Conventional chemotherapy and radiotherapy have very limited efficacy in patients with advanced chondrosarcoma. In the present study, we reported a novel therapeutic approach in
Wenyi Sun et al.
PloS one, 10(5), e0125976-e0125976 (2015-05-15)
Oral squamous cell carcinoma (OSCC) comprises a subset of head and neck squamous cell carcinoma (HNSCC) with poor therapeutic outcomes and high glycolytic dependency. Neoadjuvant chemotherapy regimens of docetaxel, cisplatin and 5-fluorouracil (TPF) are currently accepted as standard regimens for
Balkrishna Chaube et al.
Oncotarget, 6(35), 37281-37299 (2015-10-21)
Melanoma is a largely incurable skin malignancy owing to the underlying molecular and metabolic heterogeneity confounded by the development of resistance. Cancer cells have metabolic flexibility in choosing either oxidative phosphorylation (OXPHOS) or glycolysis for ATP generation depending upon the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico