Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU183581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nanog

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGCCTAGTTCTGAGGAAGCATCGAATTCTGGGAACGCCTCATCAATGCCTGCAGTTTTTCATCCCGAGAACTATTCTTGCTTACAAGGGTCTGCTACTGAGATGCTCTGCACAGAGGCTGCCTCTCCTCGCCCTTCCTCTGAAGACCTGCCTCTTCAAGGCAGCCCTGATTCTTCTACCAGTCCCAAACAAAAGCTCTCAAGTCCTGAGGCTGACAAGGGCCCTGAGGAGGAGGAGAACAAGGTCCTTGCCAGGAAGCAGAAGATGCGGACTGTGTTCTCTCAGGCCCAGCTGTGTGCACTCAAGGACAGGTTTCAGAAGCAGAAGTACCTCAGCCTCCAGCAGATGCAAGAACTCTCCTCCATTCTGAACCTGAGCTATAAGCAGGTTAAGACCTGGTTTCAAAACCAAAGGATGAAGTGCAAGCGGTGGCAGAAAAACCAGTGGTTGAAGACTAGCAATGGTCTGATTCAGAAGGGCTCAGCACCAGTGGAGTATCCCAGCATCCATTGC

Ensembl | nº de acceso | ratón

ENSMUSG00000012396

Nº de acceso NCBI

NM_028016

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NANOG(71950) , Nanog(71950)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HRS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Despina Bazou et al.
Ultrasound in medicine & biology, 37(2), 321-330 (2011-01-07)
In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08-0.85 MPa) and times (5-60 min) was performed. Our results
J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Khalid Arif et al.
OncoTargets and therapy, 8, 1327-1334 (2015-06-18)
There is an accumulation of evidence that shows a significant role of cancer stem cells in tumor initiation, proliferation, relapse, and metastasis. Nanog is the most important core transcription marker of stem cells, known by its role in maintaining pluripotency

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico