Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU182841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd68

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTTGGGGCATATCTGTTTTGAATCCCAACAAAACCAAGGTCCAGGGAGGTTGTGACGGTACCCATCCCCACCTGTCTCTCTCATTTCCTTATGGACAGCTTACCTTTGGATTCAAACAGGACCTACATCAGAGCCCGAGTACAGTCTACCTGGACTACATGGCGGTGGAATACAATGTGTCCTTCCCACAGGCAGCACAGTGGACATTCATGGCGCAGAATTCATCTCTTCGAGAGCTCCAAGCTCCCTTGGGCCAAAGCTTCTGCTGTGGAAATGCAAGCATAGTTCTTTCTCCAGCTGTTCACCTTGACCTGCTCTCTCTAAGGCTACAGGCTGCTCAGCTGCCTGACAAGGGACACTTCGGGCCATGTTTCTCTTGCAACCGTGACCAGTCCCTCTTGCTGCCTCTCATCATTGGCCTGGTCCTCCTCGGCCTCCTCACCCTGGTGCTCATCGCCTTCTGCATCACCCGCAGACGACAATCAACCTACCAGCCCCTCTGAGCATC

Ensembl | nº de acceso | ratón

ENSMUSG00000018774

Nº de acceso NCBI

NM_009853

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CD68(12514) , Cd68(12514)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Bao-xiang Pei et al.
The Journal of thoracic and cardiovascular surgery, 148(4), 1208-1216 (2014-06-08)
Recent experimental evidence has indicated that interstitial tumor-associated macrophages (TAMs), tumor-derived macrophage colony-stimulating factor (also known as CSF-1), and interleukin-6 (IL-6) interact in the pathogenesis of malignant epithelial tumors, including lung cancer. The present study aimed to explore their relationship
Carlos Tarin et al.
Scientific reports, 5, 17135-17135 (2015-12-01)
CD163 is a membrane receptor expressed by macrophage lineage. Studies performed in atherosclerosis have shown that CD163 expression is increased at inflammatory sites, pointing at the presence of intraplaque hemorrhagic sites or asymptomatic plaques. Hence, imaging of CD163 expressing macrophages
Andrea Doni et al.
The Journal of experimental medicine, 212(6), 905-925 (2015-05-13)
Pentraxin 3 (PTX3) is a fluid-phase pattern recognition molecule and a key component of the humoral arm of innate immunity. In four different models of tissue damage in mice, PTX3 deficiency was associated with increased fibrin deposition and persistence, and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico