Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU180081

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mif

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCGCTTTGTACCGTCCTCCGGTCCACGCTCGCAGTCTCTCCGCCACCATGCCTATGTTCATCGTGAACACCAATGTTCCCCGCGCCTCCGTGCCAGAGGGGTTTCTGTCGGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCGCACAGTACATCGCAGTGCACGTGGTCCCGGACCAGCTCATGACTTTTAGCGGCACGAACGATCCCTGCGCCCTCTGCAGCCTGCACAGCATCGGCAAGATCGGTGGTGCCCAGAACCGCAACTACAGTAAGCTGCTGTGTGGCCTGCTGTCCGATCGCCTGCACATCAGCCCGGACCGGGTCTACATCAACTATTACGACATGAACGCTGCCAACGTGGGCTGGAACGGTTCCACCTTCGCTTGAGTCCTGGCCCCACTTACCTGCACCGCTGTTCTTTGAGCCTCGCTCCACGTAGTGTTCTGTGTTTATCCACCGGTAGCGATGCCCACCTTC

Ensembl | nº de acceso | ratón

ENSMUSG00000033307

Nº de acceso NCBI

NM_010798

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MIF(17319) , Mif(17319)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZRU
PRU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie Zeng et al.
Molecular medicine reports, 13(1), 174-180 (2015-11-10)
Macrophage migration inhibitory factor (MIF) is closely associated with tumorigenesis. The present study aimed to investigate the effects of MIF on the proliferation, migration and colony formation of oral squamous cell carcinoma (OSCC), and to quantify the protein expression levels
Y Liu et al.
Cell death & disease, 5, e1361-e1361 (2014-08-08)
Osteosarcoma is a common primary bone tumor in children and adolescents. The drug resistance of osteosarcoma leads to high lethality. Macrophage migration inhibitory factor (MIF) is an inflammation-related cytokine implicated in the chemoresistance of breast cancer. In this study, we
Eun Ju Jeong et al.
Nanoscale, 7(47), 20095-20104 (2015-11-17)
Although chitosan and its derivatives have been frequently utilized as delivery vehicles for small interfering RNA (siRNA), it is challenging to improve the gene silencing efficiency of chitosan-based nanoparticles. In this study, we hypothesized that controlling the spacer arm length
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the
Bruno Costa-Silva et al.
Nature cell biology, 17(6), 816-826 (2015-05-20)
Pancreatic ductal adenocarcinomas (PDACs) are highly metastatic with poor prognosis, mainly due to delayed detection. We hypothesized that intercellular communication is critical for metastatic progression. Here, we show that PDAC-derived exosomes induce liver pre-metastatic niche formation in naive mice and consequently
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico