Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU177361

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Arid1a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGATCAGATGGGAAAGATGAGACCTCAGCCGTATGGTGGGACTAACCCATACTCGCAACAACAGGGACCTCCTTCAGGACCGCAACAAGGACATGGGTACCCAGGGCAGCCATATGGGTCCCAGACTCCACAGCGGTACCCCATGACCATGCAGGGCCGGGCTCAGAGTGCCATGGGCAGCCTCTCTTATGCACAGCAGATTCCACCTTATGGCCAGCAAGGCCCCAGTGCGTATGGCCAGCAGGGCCAGACTCCATACTATAACCAGCAAAGTCCTCATCCCCAGCAGCAGCCACCTTACGCCCAGCAACCACCATCCCAGACCCCTCATGCCCAG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nan Wang et al.
Gynecologic oncology, 134(1), 129-137 (2014-05-06)
MicroRNAs(miRNAs) play important roles in tumor development and progression. The purposes of this study were to investigate the role of miR-31 in cervical cancer and clarified the regulation of ARID1A by miR-31. Quantitative RT-PCR was used to examine miR-31 expression
Xuxu Sun et al.
Cancer cell, 32(5), 574-589 (2017-11-15)
ARID1A, an SWI/SNF chromatin-remodeling gene, is commonly mutated in cancer and hypothesized to be tumor suppressive. In some hepatocellular carcinoma patients, ARID1A was highly expressed in primary tumors but not in metastatic lesions, suggesting that ARID1A can be lost after

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico