Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU173171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chn1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGAAGATGTCAAGATGGCTTTTGATAGAGATGGTGAGAAGGCGGATATTTCTGTGAACATGTATGAGGACATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATCTGCCAATTCCTCTCATCACATACGATGCCTACCCCAAGTTCATTGAGTCTGCCAAAATTATGGACCCTGACGAGCAATTGGAGACCCTTCACGAAGCACTGAGATCGCTGCCGCCTGCCCACTGCGAGACGCTCCGGTACCTCATGGCGCATCTCAAGAGAGTGACCCTTCATGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATCGTGTTTGGACCAACCCTCATGAGATCCCCAGAGCTCG

Ensembl | nº de acceso | ratón

ENSMUSG00000056486

Nº de acceso NCBI

NM_029716

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CHN1(108699) , Chn1(108699)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junlan Feng et al.
Journal of cellular and molecular medicine, 18(10), 2125-2134 (2014-09-19)
Our previously published study documented a deregulation of the microRNA miR-150 in colorectal cancer. Here, we investigated further, in vitro and in vivo, the potential molecular mechanisms underlying the involvement of miR-150 in colorectal cancer, using the appropriate molecular biological
Chao Zeng et al.
American journal of physiology. Endocrinology and metabolism, 307(4), E384-E397 (2014-07-10)
Activation of conventional PKCs (cPKC) is a key signaling that directs the cardiac toxicity of hyperglycemia. AKAP150, a scaffold protein of the A-kinase anchoring proteins (AKAPs) family, is less defined regarding its capability to anchor and regulate cardiac cPKC signaling.
Han Lin et al.
Molecular and cellular biology, 35(21), 3657-3668 (2015-08-19)
Cdc14 is a phosphatase that controls mitotic exit and cytokinesis in budding yeast. In mammals, the two Cdc14 homologues, Cdc14A and Cdc14B, have been proposed to regulate DNA damage repair, whereas the mitotic exit and cytokinesis rely on another phosphatase
Peng Yang et al.
Cellular signalling, 27(7), 1525-1532 (2015-03-18)
Surgery-induced inflammation has been associated with cancer recurrence and metastasis in colorectal cancer (CRC). As a constituent of gram-negative bacteria, lipopolysaccharide (LPS) is frequently abundant in the peri-operative window. However, the definite roles of LPS in tumour progression remain elusive.
Deguang Xing et al.
Oncology reports, 31(6), 2692-2700 (2014-04-24)
In the present study, we designed and conducted a series of assays to determine the expression of voltage-gated sodium channel (VGSC) neonatal isoform Nav1.5 (nNav1.5) in human brain astrocytoma and its effect on the proliferation, migration, invasion and apoptosis of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico