Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU170301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nol3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGAGGACCTGAGAGGAAACTTGAGTAGACAGAAGCCACACACATCATTGTAACTGCTGTTTAATTGTCTGGCTTTCCTCTGAACTGGGAGCTCAGTGAGGGGCGTGGGGTCTAACCAGTCACAGACATACACAAGGAGCTCTGCACATATCTACTAAGTAAATGAATACAAACTTCCCAGCTGTGTTTCCAAGCTTCACAGATGGAAACATTAACTGAAAAGCCAGGGTTAGGACAGTACTAGCTCACTCTCCCACCGCTGAATCTGAAGTGAAATGAAAGCCTTAACCAGCTCTGTACTAATCCTGGCCTGAACGTGGGATAACAAACCCTAGGGCCTGCCCTGTAGGTTTGATTGTGGTTGCTCCCGCCTGTCCTAACCACTGCCAGAGACCAGCTGTGAGGCTGTGGTTAAAGACAGGCACAACCAAGACTAACATGGGGACTGAGGGTGGGACCAGGTGCTGGACTCACAAGACACAAGACACAGTGTGTCTGTGTGAGTGATAAGAAAGGG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and
Andrea Ullius et al.
Nucleic acids research, 42(11), 6901-6920 (2014-05-02)
The appropriate expression of the roughly 30,000 human genes requires multiple layers of control. The oncoprotein MYC, a transcriptional regulator, contributes to many of the identified control mechanisms, including the regulation of chromatin, RNA polymerases, and RNA processing. Moreover, MYC

Global Trade Item Number

Número de referencia del producto (SKU)GTIN
EMU170301-20UG4061828752942
EMU170301-50UG4061828701827

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico