Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU091061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rbpj

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTATGGCAACAGCGATGACATTGGTGTGTTCCTCAGCAAGCGGATAAAGGTCATCTCCAAACCCTCCAAAAAGAAGCAGTCACTGAAGAATGCTGACTTGTGCATTGCTTCAGGAACGAAGGTGGCACTGTTCAATCGCCTTCGGTCCCAGACAGTTAGTACCAGGTACCTGCATGTAGAAGGAGGGAATTTCCACGCCAGTTCACAACAGTGGGGAGCATTTTACATCCATCTCTTGGACGACGACGAGTCGGAAGGAGAGGAGTTCACAGTTAGAGATGGCTACATCCATTACGGGCAGACTGTCAAGCTTGTGTGCTCAGTGACTGGCATGGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACGGCATTACTGGATGCAGACGACCCTGTAT

Ensembl | nº de acceso | ratón

ENSMUSG00000039191

Nº de acceso NCBI

NM_001080927

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... RBPJ(19664) , Rbpj(19664)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hideya Onishi et al.
Cancer letters, 371(2), 143-150 (2015-12-15)
We previously demonstrated that Hedgehog (Hh) signaling is activated under hypoxia through upregulation of transcription of Smoothened (SMO) gene. However, the mechanism of hypoxia-induced activation of SMO transcription remains unclear. In the analysis of altered expressions of genes related to
M Tanaka et al.
British journal of cancer, 100(12), 1957-1965 (2009-05-21)
The study shows constitutive activation of the Notch pathway in various types of malignancies. However, it remains unclear how the Notch pathway is involved in the pathogenesis of osteosarcoma. We investigated the expression of the Notch pathway molecules in osteosarcoma
Hiroko Nagao et al.
PloS one, 7(7), e39268-e39268 (2012-07-14)
The Notch pathway regulates a broad spectrum of cell fate decisions and differentiation processes during fetal and postnatal development. In addition, the Notch pathway plays an important role in controlling tumorigenesis. However, the role of RBPJ, a transcription factor in
Robert J Lake et al.
PLoS genetics, 10(3), e1004204-e1004204 (2014-03-08)
Mechanisms that maintain transcriptional memory through cell division are important to maintain cell identity, and sequence-specific transcription factors that remain associated with mitotic chromatin are emerging as key players in transcriptional memory propagation. Here, we show that the major transcriptional
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico