Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU090571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dnmt1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAACCCCAGATGTTGACCAGTGAGAAACTGTCCATCTACGACTCCACCTCGACCTGGTTTGATACTTATGAAGATTCTCCCATGCATAGGTTCACTTCCTTCAGTGTGTACTGCAGTCGCGGGCACCTGTGTCCTGTCGACACCGGTCTCATTGAGAAGAATGTAGAGCTCTACTTTTCTGGGTGTGCCAAAGCAATTCATGACGAGAATCCATCTATGGAAGGTGGTATTAATGGCAAAAACCTCGGGCCAATCAATCAGTGGTGGCTCAGTGGCTTTGATGGTGGCGAGAAGGTGCTCATTGGCTTCTCCACTGCATTTGCTGAATACATTTTGATGGAGCCCAGCAAAGAGTATGAGCCAATATTTGGGCTGATGCAGGAGAAAATTTACATCAGCAAGATTGTTGTTGAGTTCCTGCAAAACAATCCTGATGCTGTATATGAAGACCTGATCAATAAGATTGAGACCACTGTTCCTCCTTCTACCATTAATGTGAACCGGTTCACAGAGGACTCCCTCTTACGCCACGCCCAGTTTGTAGTGAGCCAGGTAGAGAGTTACGACGAAGCCAAGG

Ensembl | nº de acceso | ratón

ENSMUSG00000004099

Nº de acceso NCBI

NM_010066

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... DNMT1(13433) , Dnmt1(13433)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WHT
LBT
VZS
XWR
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sichen Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(22), 5808-5822 (2014-09-17)
IDH1/2-mutant gliomas harbor a distinct glioma-CpG island methylation phenotype (G-CIMP) that may promote the initiation and progression of secondary pathway gliomas by silencing tumor-suppressive genes. The potential role of tumor-suppressive microRNAs (miRNA; miR) in this process is not understood. To
A K Mitra et al.
Oncogene, 34(48), 5923-5932 (2015-03-24)
The cross-talk between ovarian cancer (OvCa) cells and the metastatic microenvironment is an essential determinant of successful colonization. MicroRNAs (miRNAs) have several critical roles during metastasis; however, the role of microenvironmental cues in the regulation of miRNAs in metastasizing cancer
Kanwalat Chalertpet et al.
Cancer science, 106(10), 1333-1340 (2015-08-08)
Human papillomavirus (HPV) oncoproteins drive distinctive promoter methylation patterns in cancer. However, the underlying mechanism remains to be elucidated. Cyclin A1 (CCNA1) promoter methylation is strongly associated with HPV-associated cancer. CCNA1 methylation is found in HPV-associated cervical cancers, as well
Hui Zhang et al.
Theriogenology, 84(6), 846-852 (2015-07-22)
RNA interference is an important tool to study the gene function. Microinjection and electroporation are usually used to transfer DNA, small interference RNA (siRNA), morpholinos, and protein into oocytes or embryos. This study used a simple and effective method to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico