Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU090501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nsg1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGTGTCACCGAGAGGTTTAAGGTCTCCGTGCTGGTCCTCTTTGCCCTGGCCTTCCTCACCTGTGTCGTCTTCCTGGTTGTCTACAAAGTGTACAAGTATGACCGCGCCTGCCCTGATGGGTTTGTCTTGAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACACGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACTGTCATAAACCACTACAACGTGGCCAAGCAGAGCATCACCCGCTCCGTGTCGCCATGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCGGAACAGGAGACCGAAGCTGCAGAGAAGTCAGCTTAGCGAGCAGGGCAGGTTCCTTACGATGTGTCACTTGAAGGCAACAAGGGGACTTTGAGGGACATTTCATTAAATATAATTACCGATAATTTAGAGATTACTCATTTACGGTGCAATTGCTTCTGTTTGCTAATGCTGCTTTGCAAATTAAACTTGCTGCGGACCACCCACAGGCGTAAGAACAAGAGCATCTCAGCATTGCTTAGAGAGCTGGATGCCACTGTCCACGCTGAGGAGTCTTC

Ensembl | nº de acceso | ratón

ENSMUSG00000029126

Nº de acceso NCBI

NM_010942

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NSG1(18196) , Nsg1(18196)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Purusottam Mohapatra et al.
The international journal of biochemistry & cell biology, 66, 75-84 (2015-07-28)
Combination therapy using two or more small molecule inhibitors of aberrant signaling cascade in aggressive breast cancers is a promising therapeutic strategy over traditional monotherapeutic approaches. Here, we have studied the synergistic mechanism of resveratrol and curcumin induced apoptosis using
Daqian Wan et al.
Anti-cancer drugs, 26(9), 931-941 (2015-07-17)
Aspidin PB is a natural product extracted from Dryopteris fragrans (L.) Schott, which has been characterized for its various biological activities. We reported that aspidin PB induced cell cycle arrest and apoptosis through the p53/p21 and mitochondria-dependent pathways in human
Malte Kriegs et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 115(1), 120-127 (2015-03-23)
How EGF receptor (EGFR) inhibition induces cellular radiosensitization and with that increase in tumor control is still a matter of discussion. Since EGFR predominantly regulates cell cycle and proliferation, we studied whether a G1-arrest caused by EGFR inhibition may contribute
Haizhi Huang et al.
Journal of functional foods, 15, 464-475 (2015-06-27)
Galangin and myricetin are flavonoids isolated from vegetables and fruits which exhibit anti-proliferative activity in human cancer cells. In this study, their anti-angiogenic effects were investigated with
Koichi Shoji et al.
Oncology reports, 32(1), 65-70 (2014-05-21)
Fibroblast growth factor receptor 2 (FGFR2) is thought to mediate an important signaling pathway between prostate epithelial cells and stromal cells for maintenance of homeostasis in normal prostate tissue. Abnormalities of FGFR2 have been shown in advanced prostate cancer or
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico