Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU086651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd82

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTGTGTCAAAGTCACCAAGTATTTCCTCTTCCTCTTCAACTTGCTGTTCTTTATCCTGGGTGCTGTGATCCTGGGCTTCGGGGTGTGGATTCTTGCAGACAAGAACAGCTTCATTTCCGTCCTACAAACCTCATCCAGCTCGCTGCAGGTGGGGGCTTACGTCTTCATCGGTGTGGGCGCCATCACCATAGTGATGGGCTTCCTGGGCTGTATCGGTGCTGTCAATGAGGTCCGCTGCTTGCTGGGTCTGTACTTTGTCTTCCTTCTGCTGATCCTCATCGCACAGGTGACCGTAGGGGTCCTCTTCTACTTCAACGCTGACAAGCTGAAGAAGGAGATGGGGAACACAGTGATGGACATCATTCGCAACTACACTGCCAATGCCACCAGTAGCCGCGAGGAGGCCTGGGACTACGTGCAGGCGCAGGTCAAGTGCTGTGGCTGGGTCAGCCACTACAACTGGACAGAGAACGAGGAGCTCATGGGCTTTACCAAGACCACTTACCCATGCTCCTG

Ensembl | nº de acceso | ratón

ENSMUSG00000027215

Nº de acceso NCBI

NP_031682

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CD82(12521) , Cd82(12521)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qing-Hui Zhang et al.
Digestive diseases and sciences, 60(7), 1967-1976 (2015-02-06)
This study was to investigate the effects and mechanisms of miR-362-3p on regulation of gastric cancer (GC) cell metastasis potential. We detected miR-362-3p level in GC and adjacent normal tissues and investigated the relationship with clinicopathological factors. Next, we analyzed
Rong Zhou et al.
Acta pharmacologica Sinica, 35(11), 1375-1384 (2014-09-30)
Ryanodine receptor 2 (RyR2) is a critical component of intracellular Ca(2+) signaling in vascular smooth muscle cells (VSMCs). The aim of this study was to investigate the role of RyR2 in abnormal vascular reactivity after hemorrhagic shock in rats. SD

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico