Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU086511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thpo

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACAGCTGTCCCAAGCAGTACTTCTCAACTCCTCACACTAAACAAGTTCCCAAACAGGACTTCTGGATTGTTGGAGACGAACTTCAGTGTCACAGCCAGAACTGCTGGCCCTGGACTTCTGAGCAGGCTTCAGGGATTCAGAGTCAAGATTACTCCTGGTCAGCTAAATCAAACCTCCAGGTCCCCAGTCCAAATCTCTGGATACCTGAACAGGACACACGGACCTGTGAATGGAACTCATGGGCTCTTTGCTGGAACCTCACTTCAGACCCTGGAAGCCTCAGACATCTCGCCCGGAGCTTTCAACAAAGGCTCCCTGGCATTCAACCTCCAGGGTGGACTTCCTCCTTCTCCAAGCCTTGCTCCTGATGGACACACACCCTTCCCTCCTTCACCTGCCTTGCCCACCACCCATGGATCTCCACCCCAGCTCCACCCCCTGTTTCCTGACCCTTCCACCACCATGCCTAACTCTACCGCCCCTCATCCAGTCACAATGTACCCTCATCCCAGG

Ensembl | nº de acceso | ratón

ENSMUSG00000022847

Nº de acceso NCBI

NP_033405

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... THPO(21832) , Thpo(21832)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lina M E Pettersson et al.
PloS one, 9(6), e100730-e100730 (2014-06-27)
Peripheral nerve injury results in dramatic upregulation in pituitary adenylate cyclase activating polypeptide (PACAP) expression in adult rat dorsal root ganglia and spinal motor neurons mirroring that described for the neurotrophin brain derived neurotrophic factor (BDNF). Thus, we posited that
Sae Hyun Park et al.
International journal of oncology, 44(3), 637-646 (2014-01-01)
Fascin1 (FSCN1) involved in cell motility and filopodia assembly plays important roles in biological processes such as cancer invasion and metastasis of multiple epithelial tumors. High-grade serous ovarian carcinoma (HGSOC) is aggressive and metastatic by acquiring an invasive phenotype and
Andres E Perez Bay et al.
Journal of cell science, 127(Pt 20), 4457-4469 (2014-09-03)
Some native epithelia, for example, retinal pigment epithelium (RPE) and kidney proximal tubule (KPT), constitutively lack the basolateral sorting adaptor AP-1B; this results in many basolateral plasma membrane proteins being repositioned to the apical domain, where they perform essential functions
Linn-Karina M Selvik et al.
PloS one, 9(11), e112485-e112485 (2014-11-11)
Salt-inducible kinase 1 (SIK1/Snf1lk) belongs to the AMP-activated protein kinase (AMPK) family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome
Peng Zhang et al.
PloS one, 9(5), e97647-e97647 (2014-05-17)
Plasma kisspeptin levels dramatically increased during the first trimester of human pregnancy, which is similar to pregnancy specific glycoprotein-human chorionic gonadotropin. However, its particular role in the implantation and decidualization has not been fully unraveled. Here, the study was conducted
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico