Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU082841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nfe2l2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGAGAACATTGTCGAGCTGGAGCAAGACTTGGGCCACTTAAAAGACGAGAGAGAAAAACTACTCAGAGAAAAGGGAGAAAACGACAGAAACCTCCATCTACTGAAAAGGCGGCTCAGCACCTTGTATCTTGAAGTCTTCAGCATGTTACGTGATGAGGATGGAAAGCCTTACTCTCCCAGTGAATACTCTCTGCAGCAAACCAGAGATGGCAATGTGTTCCTTGTTCCCAAAAGCAAGAAGCCAGATACAAAGAAAAACTAGGTTCGGGAGGATGGAGCCTTTTCTGAGCTAGTGTTTGTTTTGTACTGCTAAAACTTCCTACTGTGATGTGAAATGCAGAAACACTTTATAAGTAACTATGCAGAATTATAGCCAAAGCTAGTATAGCAATAATATGAAACTTTACAAAGCATTAAAGTCTCAATGTTGAATCAGTTTCATTTTAACTCTCAAGTTAATTTCTTAGGCACCATTTGGGAG

Ensembl | nº de acceso | ratón

ENSMUSG00000015839

Nº de acceso NCBI

NM_010902

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NFE2L2(18024) , Nfe2l2(18024)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HQS
QCS
XWR
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie Zhou et al.
PloS one, 9(7), e101668-e101668 (2014-07-06)
Salvianolic acid B (SalB), a bioactive compound isolated from the plant-derived medicinal herb Danshen, has been shown to exert various anti-oxidative and anti-inflammatory activities in several neurological disorders. In this study, we sought to investigate the potential protective effects and
Jian-ping Li et al.
Acta pharmacologica Sinica, 35(8), 1031-1044 (2014-07-01)
To investigate the anti-fibrosis effects of ginsenoside Rg1 on alcohol- and CCl4-induced hepatic fibrosis in rats and to explore the mechanisms of the effects. Rats were given 6% alcohol in water and injected with CCl4 (2 mL/kg, sc) twice a
Amin Haghani et al.
eLife, 9 (2020-06-25)
The neurotoxicity of air pollution is undefined for sex and APOE alleles. These major risk factors of Alzheimer's disease (AD) were examined in mice given chronic exposure to nPM, a nano-sized subfraction of urban air pollution. In the cerebral cortex
Papavee Samatiwat et al.
Naunyn-Schmiedeberg's archives of pharmacology, 388(6), 601-612 (2015-02-25)
Resistance to chemotherapy is the major problem in cancer treatment. Cholangiocarcinoma (CCA) is the tumor arising from the bile duct epithelium. The disease is characterized by very poor prognosis and rarely responds to current radiotherapy or chemotherapy. Transcription factor Nrf2
Yi Ding et al.
International journal of cardiology, 175(3), 508-514 (2014-07-16)
Oxidative stress-induced vascular endothelial cell injury is a major factor in the pathogenesis of atherosclerosis. Several evidences indicate that ellagic acid (EA), a phenolic compound, contributes to cardiovascular health. This study was to investigate the effects of EA on endothelial
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico