Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU082041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATCAATGGCAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGATAACAGACCTGAGTTTCTGCACCAGGTTTGGAATGGGTCTGTTCCAGAGGGATCAAAGCCTGGGACGTATGTGATGACGGTCACTGCCATTGATGCGGATGATCCAAATGCCCTGAATGGAATGCTGCGGTACAGGATCCTGTCCCAGGCGCCCAGCACACCTTCACCCAACATGTTTACAATCAACAATGAGACTGGGGACATCATCACTGTGGCAGCTGGTCTGGATCGAGAGAAAGTGCAACAGTATACGTTAATAATTCAAGCCACAGACATGGAAGGCAATCCCACTTATGGCCTTTCAAACACAGCCACAGCCGTCATCACGGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACTTTCTACGGAGAAGTCCCTGAGAACAGGGTGGACGTCAT

Ensembl | nº de acceso | ratón

ENSMUSG00000024304

Nº de acceso NCBI

NM_007664

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CDH2(12558) , Cdh2(12558)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
YQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu-Huan Tsai et al.
PLoS pathogens, 9(5), e1003381-e1003381 (2013-06-06)
Listeria monocytogenes (Lm) is an invasive foodborne pathogen that leads to severe central nervous system and maternal-fetal infections. Lm ability to actively cross the intestinal barrier is one of its key pathogenic properties. Lm crosses the intestinal epithelium upon the
M-R Lee et al.
Cell death & disease, 5, e1113-e1113 (2014-03-15)
Endoplasmic reticulum (ER) stress is considered one of the pathological mechanisms of idiopathic pulmonary fibrosis (IPF). Therefore, we examined whether an ER stress regulator, Bax inhibitor-1 (BI-1), regulates collagen accumulation, which is both a marker of fibrosis and a pathological
Maorong Jiang et al.
Neurochemical research, 39(11), 2047-2057 (2014-08-15)
Chitosan-based tissue engineered nerve grafts are successfully used for bridging peripheral nerve gaps. The biodegradation products of chitosan are water-dissolvable chitooligosaccharides (COSs), which have been shown to support peripheral nerve regeneration. In this study, we aimed to examine in vitro
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Xuebing Yan et al.
Molecular medicine reports, 12(2), 2999-3006 (2015-05-06)
Recent studies have indicated that the epithelial-mesenchymal transition (EMT) is a key molecular mechanism involved in the development of colorectal cancer (CRC). N-cadherin is a mesenchymal marker of the EMT and has been closely linked to several human malignancies. However

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico