Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU081361

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ralbp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTATGCCCCGATTTGAAGAGGCTTGTGGGAAGACCACAGAGATGGAGAAAGTGCAGGAATTCCAGCGCTTGCTCCGGGAACTGCCGGAGTGCAATCATCTTCTGCTTTCCTGGCTCATTGTGCACCTGGACCACGTCATTGCGAAGGAGCTGGAAACGAAGATGAACATCCAGAACATCTCTATAGTGCTGAGCCCCACCGTGCAGATCAGCAATCGGGTCCTGTACGTGCTTTTCACACATGTGCAAGAGCTCTTTGGCACCGTGGTCCTGAAGCAAGTAACAAGACCTCTGCGCTGGTCCAACATGGCCACGATGCCCACACTGCCAGAGACCCAAGCAGGCATCAAGGAGGAGATCAGGAGACAGGAGTTCCTTTTGAATTGTTTACATCGAGATCTGCAGGGCGGGATAAAGGACTTATCTAAAGAAGAAAGATTATGGGAAGTACAGAGGATTCTGACTGCCCTCAAG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico