Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU079811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chi3l1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCAACCTGAAGACCCTCCTGTCTGTTGGAGGGTGGAAATTTGGCGAAAAAAGATTTTCCGAGATTGCCTCCAACACTGAGAGACGCACTGCTTTCGTCCGGTCGGTAGCCCCGTTCCTGCGTTCTTATGGCTTTGATGGGCTGGATCTCGCCTGGCTCTACCCTCGCTTAAGAGACAAGCAGTATTTCTCCACCCTGATCAAGGAACTGAATGCGGAATTCACAAAGGAGGTCCAGCCAGGCAGAGAGAAACTCCTGCTCAGCGCAGCTTTGTCAGCAGGAAAGGTGGCCATTGACACTGGCTATGACATCGCCCAGATAGCCCAACACCTGGATTTTATCAATCTCATGACCTACGATTTCCATGGAGTCTGGCGCCAAATCACAGGCCACCACAGCCCCCTCTTCCAAGGCCAGAAGGACACTAGGTTTGACAGATACAGCAATGTGAACTATGCCGTGCA

Ensembl | nº de acceso | ratón

ENSMUSG00000064246

Nº de acceso NCBI

NM_007695

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CHI3L1(12654) , Chi3l1(12654)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XDV

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Do-Hyun Kim et al.
Nature communications, 9(1), 503-503 (2018-02-07)
Chitinase-3-like-1 (Chi3l1) is known to play a significant role in the pathogenesis of Type 2 inflammation and cancer. However, the function of Chi3l1 in T cell and its clinical implications are largely unknown. Here we show that Chi3l1 expression was
Yu Yeon Jung et al.
Theranostics, 8(3), 749-766 (2018-01-19)
Although the important role of amyloid precursor protein (APP) in vascular diseases associated with Alzheimer's disease (AD) has been demonstrated, the underlying molecular mechanisms and physiological consequences are unclear. We aimed to evaluate vascular inflammation and atherosclerosis in Swedish mutant

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico