Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU074201

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vdac1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATGACGGGACAGAGTTTGGTGGCTCCATTTACCAGAAGGTGAACAAGAAGTTGGAGACTGCTGTCAATCTCGCCTGGACTGCAGGAAACAGTAACACTCGCTTCGGAATAGCAGCCAAGTATCAGGTCGACCCTGATGCCTGCTTTTCGGCCAAAGTGAACAACTCTAGCCTGATTGGCTTAGGGTACACTCAGACCCTAAAACCAGGTATCAAACTGACGTTGTCAGCCCTGCTCGATGGCAAGAACGTCAATGCGGGTGGCCACAAGCTTGGCCTAGGACTGGAATTTCAAGCATAAATGAATATTGTACAATCGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTACCTTTTAATGTTGTATGTTGGGGATGCGAGAGTTGATAAATACCACGTTAGACCTCCAGGCTAAGGATGACTCG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Meghraj Singh Baghel et al.
Molecular neurobiology, 56(3), 1707-1718 (2018-06-20)
Our previous report on hippocampal proteome analysis suggested the involvement of voltage-dependent anion channel (Vdac) 1 in scopolamine-induced amnesia. Further silencing of Vdac1 in young mice reduced the recognition memory. Vdac1 is a porin protein present abundantly on outer mitochondrial
A Mitra et al.
Cell death & disease, 4, e582-e582 (2013-04-06)
Cardiac hypertrophy and myocardial infarction (MI) are two major causes of heart failure with different etiologies. However, the molecular mechanisms associated with these two diseases are not yet fully understood. So, this study was designed to decipher the process of
Sergio Gonzalez et al.
The Journal of clinical investigation, 126(3), 1023-1038 (2016-02-16)
Schwann cells produce myelin sheath around peripheral nerve axons. Myelination is critical for rapid propagation of action potentials, as illustrated by the large number of acquired and hereditary peripheral neuropathies, such as diabetic neuropathy or Charcot-Marie-Tooth diseases, that are commonly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico