Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU073291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nr1h3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTTGACTTTGCCAAACAGCTCCCTGGCTTCCTACAGCTCAGCAGGGAGGACCAGATCGCCTTGCTGAAGACCTCTGCAATCGAGGTCATGCTTCTGGAGACGTCACGGAGGTACAACCCCGGCAGTGAGAGCATCACCTTCCTCAAGGACTTCAGTTACAACCGGGAAGACTTTGCCAAAGCAGGGCTGCAGGTGGAGTTCATCAACCCCATCTTTGAGTTCTCCAGAGCCATGAATGAGCTGCAACTCAATGATGCTGAGTTTGCTCTGCTCATTGCCATCAGCATCTTCTCTGCAGACCGGCCCAACGTGCAGGACCAGCTCCAAGTAGAGAGGCTGCAACACACATATGTGGAGGCCCTGCACGCCTACGTCTCCATCAACCACCCCCACGACCGACTGATGTTCCCACGGATGCTAATGAAGCTGGTGAGCC

Ensembl | nº de acceso | ratón

ENSMUSG00000002108

Nº de acceso NCBI

NP_038867

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NR1H3(22259) , Nr1h3(22259)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed
Mengyang Liu et al.
The Journal of biological chemistry, 290(23), 14418-14429 (2015-04-29)
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported
Limei Zhong et al.
Molecular immunology, 60(1), 32-43 (2014-04-22)
Liver X receptors (LXRs) are nuclear receptors that play an essential role in lipid and cholesterol metabolism. Emerging studies indicate a potential function for LXRs in regulating dendritic cell (DC)-dependent immune responses; however, the role of LXRs in DC differentiation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico