Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU071551

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nlk

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAATGAGGACAGCTTGTGAAGGTGCTAAGGCACACATACTCAGGGGTCCTCATAAACAGCCATCTCTTCCTGTGCTCTACACCCTCTCCAGCCAGGCCACACATGAAGCTGTTCACCTGCTTTGCAGGATGTTGGTCTTTGATCCATCAAAAAGAATATCCGCTAAGGATGCCTTAGCCCACCCCTACCTAGATGAAGGGCGGCTGAGATACCATACGTGTATGTGCAAGTGCTGCTTTTCCACCTCAACGGGGAGAGTCTACACCAGTGACTTTGAGCCTGTCACCAACCCCAAATTTGATGACACCTTTGAGAAGAACCTCAGCTCTGTCCGACAGGTTAAAGAAATTATCCACCAGTTCATTCTGGAACAGCAGAAAGGAAACAGAGTGCCTCTCTGCATCAACCCGCAGTCCGCTGCCTTTAAGAG

Ensembl | nº de acceso | ratón

ENSMUSG00000017376

Nº de acceso NCBI

NM_008702

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NLK(18099) , Nlk(18099)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dongling Zou et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6725-6732 (2015-04-03)
Chemotherapy is the preferred therapeutic approach for the therapy of advanced ovarian cancer, but 5-year survival rate remains low due to the development of drug resistance. Increasing evidence has documented that microRNAs (miRNAs) act important roles in drug resistance in
Gina Shaw-Hallgren et al.
PloS one, 9(5), e96506-e96506 (2014-05-13)
Nemo-like kinase (NLK), a proline-directed serine/threonine kinase regulated by phosphorylation, can be localized in the cytosol or in the nucleus. Whether the localization of NLK can affect cell survival or cell apoptosis is yet to be disclosed. In the present

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico