Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU071461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mrc2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGTCTTCGGATGGCAGTGTCGTACACTAGGGGACCAGTTGTCCCTGCTTCTGGGGGCTCGTGCAAGCAATGCATCCAAGCCTGGCACCTGGAGCGCGGTGACCAGACCCGCAGTGGCCATTGGAACATCTATGGCAGTGAAGAAGACCTATGTGCTCGACCTTACTATGAGGTCTACACCATCCAGGGAAACTCACACGGAAAGCCGTGCACTATCCCCTTCAAATACGACAACCAGTGGTTCCACGGCTGCACCAGCACTGGCAGAGAAGATGGGCACCTGTGGTGTGCCACCACCCAGGACTACGGCAAAGATGAGCGCTGGGGCTTCTGCCCCATCAAGAGTAACGACTGTGAGACCTTCTGGGACAAAGACCAGCTGACTGACAGCTGTTACCAGTTTAACTTCCAATCCACACTGTCCTGGAGG

Ensembl | nº de acceso | ratón

ENSMUSG00000020695

Nº de acceso NCBI

NM_008626

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MRC2(17534) , Mrc2(17534)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yangbin Pan et al.
Scientific reports, 4, 6660-6660 (2014-10-23)
The M-type phospholipase A2 receptor (PLA2R) is expressed in podocytes in human glomeruli. Group IB secretory phospholipase A2 (sPLA2 IB), which is one of the ligands of the PLA2R, is more highly expressed in chronic renal failure patients than in
N D Quach et al.
Molecular pharmaceutics, 11(10), 3443-3451 (2014-09-06)
The M-type phospholipase A2 receptor (PLA2R1) is a member of the C-type lectin superfamily and can internalize secreted phospholipase A2 (sPLA2) via endocytosis in non-cancer cells. sPLA2 itself was recently shown to be overexpressed in prostate tumors and to be

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico