Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU071401

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mknk1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATAACTCCCTGTGGCTGGAAGACACCAGTCTTGGGATTCCTCTGAGACTCCAAGTTAAAGAACCTTGTGGAGATGGGCAGCAGTGAGCCCCTTCCCATCGTGGATTCTGACAAGAGGAGGAAGAAGAAGCGTAAGACCCGGGCCACCGACTCTCTGCCAGGAAAGTTTGAAGATGTGTACCAGCTGACCTCGGAATTGCTGGGAGAAGGAGCCTATGCCAAAGTCCAGGGTGCTGTGAACCTACAGAGTGGGAAGGAGTATGCTGTCAAAATCATCGAGAAGCAAGCCGGGCACAGTCGAAGTCGAGTGTTCCGTGAGGTGGAGACACTGTATCAGTGTCAAGGGAACAGGAACATTTTGGAGCTGATTGAATTCTTTGAAGATGACACACGGTTTTACTTGGTCTTTGAGAAATTGCAAGGAGGCT

Ensembl | nº de acceso | ratón

ENSMUSG00000028708

Nº de acceso NCBI

NP_067436

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MKNK1(17346) , Mknk1(17346)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sergio Rius-Pérez et al.
Scientific reports, 9(1), 3775-3775 (2019-03-09)
p38α MAPK negatively regulates the G1/S and G2/M cell cycle transitions. However, liver-specific p38α deficiency impairs cytokinesis and reduces hepatocyte proliferation during cirrhosis and aging in mice. In this work, we have studied how p38α down-regulation affects hepatocyte proliferation after
Michael C Brown et al.
Journal of virology, 88(22), 13149-13160 (2014-09-05)
Translation machinery is a major recipient of the principal mitogenic signaling networks involving Raf-ERK1/2 and phosphoinositol 3-kinase (PI3K)-mechanistic target of rapamycin (mTOR). Picornavirus internal ribosomal entry site (IRES)-mediated translation and cytopathogenic effects are susceptible to the status of such signaling

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico