Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU071351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Src

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGAGGAAGGTGGATGTCAGAGAGGGAGACTGGTGGCTGGCACACTCGCTGAGCACGGGACAGACCGGTTACATCCCCAGCAACTATGTGGCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTACTTTGGCAAGATCACTAGACGGGAATCAGAGCGGCTGCTGCTCAACGCCGAGAACCCGAGAGGGACCTTCCTCGTGAGGGAGAGTGAGACCACAAAAGGTGCCTACTGCCTCTCTGTATCCGACTTCGACAATGCCAAGGGCCTAAATGTGAAACACTACAAGATCCGCAAGCTGGACAGCGGCGGTTTCTACATCACCTCCCGCACCCAGTTCAACAGCCTGCAGCAGCTCGTGGCTTACTACTCCAAACATGCTGATGGCCTGTGTCACCGCCTCACTACCGTATGTCCCACATCCAAGCCT

Ensembl | nº de acceso | ratón

ENSMUSG00000027646

Nº de acceso NCBI

NP_033297

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SRC(20779) , Src(20779)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaohua Guo et al.
PloS one, 15(4), e0231739-e0231739 (2020-05-01)
We previously reported microvascular leakage resulting from fibrinogen-γ chain C-terminal products (γC) occurred via a RhoA-dependent mechanism. The objective of this study was to further elucidate the signaling mechanism by which γC induces endothelial hyperpermeability. Since it is known that
M Katie Conley-LaComb et al.
Molecular cancer, 15(1), 68-68 (2016-11-05)
The CXCL12/CXCR4 axis transactivates HER2 and promotes intraosseous tumor growth. To further explore the transactivation of HER2 by CXCL12, we investigated the role of small GTP protein G We used a variety of methods such as lipid raft isolation, invasion
Wei Liu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3033-3046 (2018-02-07)
Hepatitis B virus core protein (HBc) is expressed preferentially in hepatitis B virus (HBV)-associated hepatocellular carcinoma (HCC). HBc can function as an oncogene arising from its gene regulatory properties, but how it contributes functionally to hepatocarcinogenesis remains unclear. In this
Jun Wang et al.
Oncotarget, 8(48), 83872-83889 (2017-11-16)
Src has been reported to mediate tissue fibrosis in several organs, but its role in peritoneal fibrosis remains unknown. In this study, we evaluated the therapeutic effect of KX2-391, a highly selective inhibitor of Src, on the development of peritoneal
Yiming Liu et al.
Journal of cellular and molecular medicine, 23(4), 2399-2409 (2019-01-25)
Golgi phosphoprotein 73 (GP73) has been regarded as a novel serum biomarker for the diagnosis of hepatocellular carcinoma (HCC) in recent years. It has been reported that the upregulation of GP73 may promote the carcinogenesis and metastasis of HCC; however
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico