Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU071131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nfkb1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGAGGCAGCACATAGATGAACTCCGGGATAGTGACAGCGTCTGTGACAGTGGTGTGGAGACATCCTTCCGCAAACTCAGCTTTACAGAGTCTCTTACTGGAGACAGCCCACTGCTATCTCTGAACAAAATGCCCCACGGTTATGGGCAGGAAGGACCTATTGAAGGCAAAATTTAGCCTGCTGGCCGTTCCCCCACACTGTGTAAACCAAAGCCCTGACAGTCCATTGCATCGTCCCAAAGGAGGAAGGCAAAGCGAATCCAAAGGTGCTGGAGAATCGCCGGCCTGCAGGGTCACTCGATTTCATTCAAGGCCTTCCGAATTTGGCGTCCTTCTTGGTTCTGAAATGAAATGTAGTTGCCACGCACAGACGGTGTCTAGCAATCATGGCGCTCGCTCGCTCAGCTGCACTCTATGGCTCAGGTGCAGTG

Ensembl | nº de acceso | ratón

ENSMUSG00000028163

Nº de acceso NCBI

NM_008689

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NFKB1(18033) , Nfkb1(18033)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tong Yuan et al.
The Journal of surgical research, 192(1), 150-162 (2014-06-24)
Lidocaine has been used as a local anesthetic with anti-inflammatory properties, but its effects on neuroinflammation have not been well defined. In the present study, we investigated the prophylactic effects of lidocaine on lipopolysaccharide (LPS)-activated microglia and explored the underlying
Ujjal Das et al.
PloS one, 9(5), e97599-e97599 (2014-05-24)
Ionizing radiation is responsible for oxidative stress by generating reactive oxygen species (ROS), which alters the cellular redox potential. This change activates several redox sensitive enzymes which are crucial in activating signaling pathways at molecular level and can lead to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico