Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU070481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGGTGACGATGAGGAAGAAGATGGAGTCAGTGAAGCAGCTAGCCTAGAGGAGCCTAAGGAAGAGGATCAAGGAGAAGGCTATTTGTCTGAGATGGATAATGAGCCCCCTGTGAGTGAGAGTGATGATGGCTTTAGTATACATAACGCCACACTGCAGTCACACACTCTGGCAGACTCCATCCCAAGCAGCCCTGCCTCCTCCCAGTTTTCCGTGTGCAGTGAAGATCAAGAAGCAATTCAGGCTCAGAAAATATGGAAGAAAGCCATCATGCTTGTATGGAGGGCTGCAGCAAATCATAGGTATGCCAATGTGTTCCTGCAACCTGTTACAGATGACATAGCTCCTGGTTACCATAGCATTGTACAGAGGCCTATGGATTTGTCAACTATAAAGAAAAACATTGAAAATGGACTGATCCGAAGCAC

Ensembl | nº de acceso | ratón

ENSMUSG00000003778

Nº de acceso NCBI

NM_030147

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... BRD8(78656) , Brd8(78656)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico