Todas las fotos(1)

Key Documents

Certificado de origen (COO)/COA

EMU064061

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting mouse Mcl1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGTTTGTGGAGTTCTTCCACGTACAGGACCTAGAAGGCGGCATCAGAAATGTGCTGCTGGCTTTTGCGGGTGTTGCTGGAGTAGGGGCTGGTCTGGCATATCTAATAAGATAGCCTTGTGAGTGCAATAGGGGACTCTTAAAGCTCCAGCCACCAAACTACATGCATCTGTGAAAACATGTGTATTTATGAAGGTGGACTTGAAGCTGCCCAGGATTTTAACAGTCCAGTTCTACTGTAGCAACATAGCAAAAAGAAAGTGGCTACAGGATTGTGGCTAACAAGAATAAATACATGGGAAAAGTGCTCCCCCTGGAAGAGTCACTGTCTGAATGAAGCAAAGTTCCCTCTCAGCAAACACTGAGAGGCCATGGAGAAGGACTTCTAGAATGAATGAAAGGGGTGGA

Ensembl | nº de acceso | ratón

ENSMUSG00000038612

Nº de acceso NCBI

NM_008562

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MCL1(17210) , Mcl1(17210)

Categorías relacionadas

MISSION® esiRNA

Descripción general

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Evaluation of apoptosis induction by concomitant inhibition of MEK, mTOR, and Bcl-2 in human acute myelogenous leukemia cells.

Weiguo Zhang et al.

Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)

Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects

Cadherin-11 in poor prognosis malignancies and rheumatoid arthritis: common target, common therapies.

Shahin Assefnia et al.

Oncotarget, 5(6), 1458-1474 (2014-04-01)

Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.

Assessing how reduced expression levels of the mismatch repair genes MLH1, MSH2, and MSH6 affect repair efficiency.

Minttu Kansikas et al.

Human mutation, 35(9), 1123-1127 (2014-06-14)

Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene

The PD-L1/CD86 ratio is increased in dendritic cells co-infected with porcine circovirus type 2 and porcine reproductive and respiratory syndrome virus, and the PD-L1/PD-1 axis is associated with anergy, apoptosis, and the induction of regulatory T-cells in porcine lymphocytes.

O Richmond et al.

Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)

Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of

The role of von Willebrand factor as a biomarker of tumor development in hepatitis B virus-associated human hepatocellular carcinoma: a quantitative proteomic based study.

Yi Liu et al.

Journal of proteomics, 106, 99-112 (2014-04-29)

Chronic hepatitis B virus (HBV) infection is a major risk factor for hepatocellular carcinoma (HCC), the sixth most common cancer worldwide. To explore potential biomarkers for HCC, iTRAQ coupled with mass spectrometry was used to analyze proteins in plasma from

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico