Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU061791

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptpn1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGAACAGGTACCGAGATGTCAGCCCTTTTGACCACAGTCGGATTAAATTGCACCAGGAAGATAATGACTATATCAATGCCAGCTTGATAAAAATGGAAGAAGCCCAGAGGAGCTATATTCTCACCCAGGGCCCTTTACCAAACACATGTGGGCACTTCTGGGAGATGGTGTGGGAGCAGAAGAGCAGGGGCGTGGTCATGCTCAACCGCATCATGGAGAAAGGCTCGTTAAAATGTGCCCAGTATTGGCCACAGCAAGAAGAAAAGGAGATGGTCTTTGATGACACAGGTTTGAAGTTGACACTAATCTCTGAAGATGTCAAGTCATATTACACAGTACGACAGTTGGAGTTGGAAAACCTGACTACCAAGGAGACTCGAGAGATCCTGCCTTTCCACTACACC

Ensembl | nº de acceso | ratón

ENSMUSG00000027540

Nº de acceso NCBI

NM_011201

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PTPN1(19246) , Ptpn1(19246)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Liza D Morales et al.
PloS one, 9(5), e97104-e97104 (2014-05-09)
To maintain tissue homeostasis, apoptosis is functionally linked to the cell cycle through the retinoblastoma (Rb)/E2F pathway. When the Rb tumor suppressor protein is functionally inactivated, E2F1 elicits an apoptotic response through both intrinsic (caspase-9 mediated) and extrinsic (caspase-8 mediated)
Xiaoyan Zhang et al.
Scientific reports, 5, 12987-12987 (2015-08-12)
Renal mesangial cells (RMCs) constitute a population of cells in glomerular mesangium. Inflammatory cytokines produced by RMCs play a vital role in renal inflammation. miRNAs are key regulators of inflammatory cytokine expression. The abnormal expression of renal miRNAs and the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico