Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU060971

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tmem132a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCACCCTCTGGACTGCTAAGTTAGACCGCTTCAAGGGCTCAAAGCACCACACCAGCCTGATCACCTGTCACCGTGCTGGGCCTGCAGGGCCAGATTCCAGCCCCCTTGAACTGTCCGAGTTCCTGTGGGTGGACTTTGCAGTGGAGAACAGCACTGGTGGGGGTGTGGCAGTCACTCGCCCTGTCACGTGGCAGCTGGAGTACCCAGGTCAGGCCCCCGAAGCAGAGAAGGACAAAATGGTGTGGGAGATCCTGGTGTCTGAGCGGGACATCAGAGCCCTCATCCCTCTGGCCAAGGCTGAGGAGCTGGTGAACACGGCTCCATTGACTGGAGTGCCCCAGCGTATTCCGGTGCGGCTCGTCACTGTGGACAGTGGGGGAGCCTTGGAGGAGGTGACAGAGC

Ensembl | nº de acceso | ratón

ENSMUSG00000024736

Nº de acceso NCBI

NM_133804

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... TMEM132A(98170) , Tmem132a(98170)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Deng He et al.
International journal of molecular sciences, 16(7), 16313-16329 (2015-07-21)
The molecular events leading to nephrolithiasis are extremely complex. Previous studies demonstrated that calcium and transforming growth factor-β1 (TGF-β1) may participate in the pathogenesis of stone formation, but the explicit mechanism has not been defined. Using a self-created genetic hypercalciuric
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico