Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU060801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stk11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGAGGCCAACGTCAAGAAGGAGATCCAGCTGCTGCGGCGGCTGCGGCATCGGAATGTGATCCAGCTTGTGGACGTGCTGTACAATGAGGAGAAGCAGAAGATGTATATGGTGATGGAGTACTGCGTATGTGGCATGCAGGAGATGCTGGACAGTGTGCCGGAGAAGCGCTTCCCTGTGTGCCAAGCTCATGGGTACTTCCGCCAGCTGATTGACGGCCTGGAATACCTACACAGCCAGGGCATTGTTCACAAGGACATCAAGCCGGGCAACCTGCTACTCACCACCAATGGCACACTCAAGATCTCCGACCTCGGTGTTGCCGAGGCCCTGCACCCTTTCGCTGTGGATGACACCTGCCGGACAAGCCAGGGCTCCCCGGCCTTCCAGCCTCCTGAGATTG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fanny Dupuy et al.
Cancer & metabolism, 1(1), 18-18 (2013-11-28)
Germline and somatic mutations in STK11, the gene encoding the serine/threonine kinase LKB1, are strongly associated with tumorigenesis. While loss of LKB1 expression has been linked to breast cancer, the mechanistic role of LKB1 in regulating breast cancer development, metastasis
Ngai Na Co et al.
Cancer, 120(22), 3457-3468 (2014-07-22)
Liver kinase B1 (LKB1) is a serine/threonine kinase that functions as a tumor suppressor and regulates cell polarity, proliferation, and metabolism. Mutations in LKB1 are associated with Peutz-Jeghers syndrome as well as sporadic cervical and lung cancers. Although LKB1-null mice
Juan Li et al.
Journal of experimental & clinical cancer research : CR, 33, 70-70 (2014-09-03)
LKB1, also known as STK11, is a master kinase that serves as an energy metabolic sensor and is involved in cell polarity regulation. Recent studies have indicated that LKB1 is related to breast tumorigenesis and breast cancer progression. However, little
Kaisheng Mao et al.
Lung cancer (Amsterdam, Netherlands), 88(2), 131-138 (2015-03-15)
The tumor suppressor LKB1 has recently been shown to be involved in the regulation of microtubule dynamics, thus cancer cells with inactivated LKB1 may have developed a means to overcome dysregulated microtubule functions, making them intrinsically resistant to microtubule targeting
Shabnam Pooya et al.
Nature communications, 5, 4993-4993 (2014-09-27)
A prerequisite to myelination of peripheral axons by Schwann cells (SCs) is SC differentiation, and recent evidence indicates that reprogramming from a glycolytic to oxidative metabolism occurs during cellular differentiation. Whether this reprogramming is essential for SC differentiation, and the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico