Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU059761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gsk3b

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAGGCCACAGGAAGTCAGTTATACAGACACGAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCTGGAGAACTGGTTGCCATCAAGAAAGTTCTACAGGACAAGCGATTTAAGAACCGAGAGCTCCAGATCATGAGAAAGCTAGACCACTGTAACATAGTCCGACTGCGGTATTTCTTCTACTCGAGTGGCGAGAAGAAAGATGAGGTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAGACAGTGTACAGAGTCGCCAGACACTATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTGTATATGTATCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGAATCTGCCATCGAGACAT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yunfeng Fu et al.
OncoTargets and therapy, 7, 1159-1168 (2014-07-17)
Glycogen synthase kinase-3 (GSK-3) plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/β(Tyr279/216) in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition
Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
I Azoulay-Alfaguter et al.
Oncogene, 34(35), 4613-4623 (2014-12-17)
There is controversy over the role of glycogen synthase kinase-3 (GSK-3) in cancer progression. Recent work has implicated GSK-3 in the regulation of mammalian target of rapamycin (mTOR), a known player in malignant transformation. Autophagy, a self-degradation pathway, is inhibited

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico