Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU059571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cxcl16

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTGCACATAGTCAGAGCACTCAGCACTCCACTCTTCCATCAGGAGCACTGTCCTTAAACAAAGAGCACACCCAACCCTGGGAGATGACCACTCTCCCTTCAGGCTATGGTCTGGAAGCTAGGCCTGAGGCTGAGGCAAATGAGAAACAGCAAGATGACAGACAGCAAGAAGCACCAGGAGCTGGAGCTAGCACACCAGCTTGGGTACCGGTGCTGTCCCTCCTGGCCATTGTCTTCTTCCTCACTGCAGCCATGGCCTATGTGCTGTGCAACAGGAGAGCGACACAGCAGAACTCTGCAGGTTTGCAGCTCTGGTACACTCCTGTTGAACCAAGACCCTAGCGCCTACAGCAAGAGTGGAAGCTCATTAGAGATGGATGATGACATGGGAGAGGTGGT

Ensembl | nº de acceso | ratón

ENSMUSG00000018920

Nº de acceso NCBI

NM_023158

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CXCL16(66102) , Cxcl16(66102)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Audrey Dieudonné et al.
PloS one, 7(8), e41952-e41952 (2012-08-11)
Scavenger receptors and Toll-like receptors (TLRs) cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (ds)RNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed
Xu Chang Geng et al.
Molecular medicine reports, 11(5), 3860-3865 (2015-01-13)
Erythropoietin (EPO) is a hematopoietic hormone that protects against renal interstitial fibrosis in animal models; however, the mechanism underlying the anti‑fibrotic activity of EPO has remained elusive. The present study aimed to elucidate this mechanism. Twenty‑four male C57BL6 mice were

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico