Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU057631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc20

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCAGAAGGCTACCAGAACAGACTGAAAGTACTGTACAGTCAGAAAGCCACGCCTGGCTCCAGCAGGAAGACTTGCAGATACATCCCTTCTCTGCCAGACAGGATCCTTGATGCCCCCGAAATCCGGAATGACTACTACCTGAATCTTGTAGATTGGAGCTCTGGAAATGTATTGGCTGTGGCACTGGACAACAGTGTGTACTTATGGAACGCTGGTTCTGGTGACATCCTGCAGTTGTTGCAAATGGAGCAGCCTGGAGACTACATATCCTCGGTGGCCTGGATCAAGGAGGGCAACTACCTAGCTGTAGGCACCAGCAATGCTGAGGTCCAGCTCTGGGATGTGCAGCAGCAGAAACGACTTCGAAACATGACCAGTCACTCCGCTCGAGTAAGCTCCCTCAGTTGGAACAGCTATATCCTATCCAGTGGTTCACGGTCTGGCCACATCCACCACCATGATGTTCGGGTAGCAGAACACCATGTGGCCACACTGAGTGGCCATAGCCAGGAAGTATGTGGGC

Ensembl | nº de acceso | ratón

ENSMUSG00000006398

Nº de acceso NCBI

NM_023223

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CDC20(107995) , Cdc20(107995)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jia Li et al.
International journal of oncology, 45(4), 1547-1555 (2014-07-30)
Cell division cycle 20 (CDC20) encodes a regulatory protein interacting with the anaphase-promoting complex/cyclosome (APC/C) in the cell cycle and plays important roles in tumorigenesis and progression of multiple tumors. The present study aimed to investigate the clinical significance of
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico