Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU056331

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rps6ka3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCACCTAGTGCTAACGCACATCAGCTTTTTCGGGGGTTTAGTTTTGTTGCTATTACCTCAGATGATGAAAGCCAAGCTATGCAGACAGTTGGTGTGCATTCAATTGTTCAGCAATTACACAGAAACAGTATTCAGTTTACTGATGGATATGAAGTAAAAGAGGATATTGGCGTTGGCTCATACTCCGTTTGTAAGAGATGTATACATAAAGCTACAAACATGGAGTTTGCCGTGAAGATTATTGATAAAAGCAAGAGAGACCCAACAGAAGAGATTGAAATTCTTCTTCGCTATGGACAGCATCCAAACATCATTACCCTAAAGGATGTGTATGATGATGGAAAATATGTGTATGTAGTAACAGAACTTATGAAAGGAGGTGAATTGCTGGATAAGATTCTTAGACAGAAGTTTTTCTCAGAGCGAGAGGCCAGCGCTGTCCTGTTTACTATAACCAAAACTGTTGAGTATCTTCATGCACAAGGGGTGGTTCACAGAG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Luis Carretero et al.
Cellular signalling, 27(9), 1720-1730 (2015-05-30)
The transduction pathway mediating the inhibitory effect that TRH exerts on r-ERG channels has been thoroughly studied in GH3 rat pituitary cells but some elements have yet to be discovered, including those involved in a phosphorylation event(s). Using a quantitative

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico