Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU052231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Park7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGCAGTGTAGCCGTGATGTAATGATTTGTCCAGATACCAGTCTGGAAGATGCAAAAACGCAGGGACCATACGATGTGGTGGTTCTTCCAGGAGGAAATCTGGGTGCACAGAATTTATCTGAGTCGCCTATGGTGAAGGAGATCCTCAAGGAGCAGGAGAGCAGGAAGGGCCTCATAGCTGCCATCTGTGCAGGTCCTACGGCTCTGTTGGCTCACGAAGTAGGTTTTGGATGCAAGGTCACAACACACCCACTGGCTAAGGACAAAATGATGAATGGCAGTCACTACAGCTACTCAGAGAGCCGCGTGGAGAAGGACGGCCTGATCCTCACCAGCCGCGGGCCGGGGACCAGCTTTGAGTTTGCACTAGCCATTGTGGAGGCACTCGTGGGGAAAGACATGGCCAACCAAGTGAAGGCACCGCTTGTTCTCAAAGACTAGAGCCCAAGCCC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jung-Min Kim et al.
Scientific reports, 4, 4805-4805 (2014-06-14)
Adipose tissue functions as an endocrine organ, and the development of systemic inflammation in adipose tissue is closely associated with metabolic diseases, such as obesity and insulin resistance. Accordingly, the fine regulation of the inflammatory response caused by obesity has
Ismail Ahmed Ismail et al.
Journal of cellular physiology, 230(9), 2262-2269 (2015-02-14)
2'-Benzoyloxycinnamaldehyde (BCA) is a promising antitumor agent. BCA effectively inhibited proliferation of MDA-MB-435 more than in MCF-7 breast cancer cells. Our recent findings showed that DJ-1 protects MCF7 cells from BCA-induced oxidative stress via its mitochondrial translocation and inhibition of
Hong Zhu et al.
Free radical biology & medicine, 71, 121-132 (2014-04-01)
Dihydroartemisinin (DHA), one of the main metabolites of artemisinin and its derivatives, presents anti-cancer potential in vitro and in vivo. To explore the mechanisms of resistance toward DHA, a DHA-resistant cell line, HeLa/DHA, was established with a resistance factor of
Min Sik Choi et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(45), 15123-15131 (2014-11-08)
Emerging evidence suggests that oxidative/nitrosative stress, as occurs during aging, contributes to the pathogenesis of Parkinson's disease (PD). In contrast, detoxification of reactive oxygen species and reactive nitrogen species can protect neurons. DJ-1 has been identified as one of several
Cailing Liu et al.
Investigative ophthalmology & visual science, 55(9), 5551-5560 (2014-08-02)
To investigate the role of DJ-1 in Nrf2-regulated antioxidant defense in corneal endothelial cells (CECs) at baseline and in response to ultraviolet A (UV-A)-induced oxidative stress. DJ-1-deficient CECs were obtained by transfection of an immortalized normal human corneal endothelial cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico