Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU051511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAAAGTGCTGCAGTGGCATCCTCAAGGAGATGTTTGCCAAGAAACATGCTGCCTATGCCTGGCCTTTCTACAAGCCTGTGGATGTGGAGGCACTGGGTCTGCACGACTACTGTGACATCATCAAACATCCCATGGACATGAGCACAATCAAGTCTAAACTAGAGTCCCGAGAGTACAGAGATGCCCAGGAATTTGGTGCTGATGTCCGATTGATGTTCTCCAACTGCTACAAGTACAACCCCCCTGACCATGAAGTGGTAGCCATGGCTCGAAAACTCCAGGATGTGTTTGAAATGCGCTTTGCCAAGATGCCTGATGAGCCTGAAGAGCCAGTTGTTACAGTGTCCTCTCCTGCAGTGCCACCCCCTACAAAGGTGGTAGCCCCACCCTCATCTAGTGACAGCAGCAGCGACAGTTCTTCCGACAGCGACAGTTCCACTGA

Ensembl | nº de acceso | ratón

ENSMUSG00000024002

Nº de acceso NCBI

NM_198094

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... BRD4(57261) , Brd4(57261)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Vaibhav Sahai et al.
Molecular cancer therapeutics, 13(7), 1907-1917 (2014-05-09)
Pancreatic ductal adenocarcinoma (PDAC) is associated with pronounced fibrosis that contributes to chemoresistance, in part, through increased histone acetylation. Because bromodomain (BRD) and extra terminal domain (BET) proteins are "readers" of histone acetylation marks, we targeted BET proteins in PDAC
Deepanwita Sengupta et al.
Epigenetics, 10(6), 460-466 (2015-05-06)
Pathologic c-Myc expression is frequently detected in human cancers, including Merkel cell carcinoma (MCC), an aggressive skin cancer with no cure for metastatic disease. Bromodomain protein 4 (BRD4) regulates gene transcription by binding to acetylated histone H3 lysine 27 (H3K27Ac)
W Liu et al.
Cell death and differentiation, 21(12), 1950-1960 (2014-08-26)
Bromodomain-containing protein 4 (BRD4) is an important epigenetic reader implicated in the pathogenesis of a number of different cancers and other diseases. Brd4-null mouse embryos die shortly after implantation and are compromised in their ability to maintain the inner cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico