Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU050451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Suz12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGGCTCCTATGCAGGAAATCCTCAGGATATACATCGCCAACCTGGATTTGCTTTTAGTCGAAATGGACCGGTAAAGAGAACACCTATCACACATATTCTTGTTTGCAGGCCAAAAAGAACAAAAGCAAGCATGTCGGAGTTTCTTGAATCTGAAGATGGAGAAGTGGAGCAGCAGAGAACATACAGCAGTGGCCACAATCGTCTCTATTTCCACAGTGATACCTGCTTACCTCTTCGGCCACAAGAAATGGAAGTAGATAGTGAAGATGAGAAAGATCCAGAATGGCTGAGAGAAAAAACCATTACTCAAATTGAAGAATTTTCTGATGTGAATGAAGGAGAGAAAGAAGTGATGAAGCTGTGGAACCTCCATGTCATGAAGCATGGATTTATTGCTGACAATCAAATGAATCATGCCTGTATGCTGTTTG

Ensembl | nº de acceso | ratón

ENSMUSG00000017548

Nº de acceso NCBI

NM_199196

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SUZ12(52615) , Suz12(52615)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Ming-de Huang et al.
Journal of hematology & oncology, 8, 50-50 (2015-05-15)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death, especially in China. And the mechanism of its progression remains poorly understood. Growing evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in many cancers
Xuefei Shi et al.
Molecular carcinogenesis, 54 Suppl 1, E1-E12 (2013-12-21)
In more recent years, long non-coding RNAs (lncRNAs) have been investigated as a new class of regulators of cellular processes, such as cell growth, apoptosis, and carcinogenesis. Although lncRNAs are dysregulated in numerous cancer types, limited data are available on
Michael Anthony Ruiz et al.
PloS one, 10(4), e0123987-e0123987 (2015-04-18)
Glucose-induced augmented vascular endothelial growth factor (VEGF) production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico