Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU048711

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Jarid2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTTTTGCAATCAGCATTTGGATCTCAGAATGAGCAAGGAAAGACCCAAGAGGAATATCATTCAGAAGAAATACGATGACAGCGATGGGATCCCGTGGTCAGAAGAGAGAGTTGTACGAAAAGTCCTGTATTTGTCCCTAAAGGAATTCAAGAATGCACAGAAAAGGCAGCATGGGGAAGGCCTTGCCGGGAGCCTGAAGGCGGTAAATGGGCTTCTTGGTAATGCCCAGGCTAAGGCACTAGGACCAGCCTCAGAGCAGTCAGAGAACGAGAAGGATGATGCCTCCCAAGTGTCCTCTACTAGCAACGATGTTAGTTCTTCAGATTTTGAAGAAGGGCCGTCGAGGAAAAGGCCCAGGCTGCAAGCACAAAGGAAGTTTGCTCAATCTCAGCCGAATAGTCCCAGCACAACTCCAGT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dandan Liang et al.
International journal of cardiology, 201, 38-48 (2015-08-25)
In mammals, the heart grows by hypertrophy but not proliferation of cardiomyocytes after birth. The paucity of cardiomyocyte proliferation limits cardiac regeneration in a variety of heart diseases. To explore the efficient strategies that drive cardiomyocyte proliferation, we employed in
Chang-Liang Su et al.
International journal of hematology, 102(1), 76-85 (2015-05-06)
It has recently been shown that JARID2 contributes to the malignant character of solid tumors, such as epithelial-mesenchymal transition in lung and colon cancer cell lines, but its role in leukemia progression is unexplored. In this study, we explored the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico