Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU046561

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atpif1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCGCTAGGAGAGAAGCAGCCACGCCCGCAACGCGAGCTGAGCAACGCCGAAGACAATGGCAGGCTCGGCGTTGGCAGTTCGGGCTCGGTTCGGTGTCTGGGGTATGAAGGTCCTGCAAACCCGAGGCTTCGTCTCGGACTCGTCGGATAGCATGGATACGGGCGCTGGCTCCATCCGAGAAGCTGGTGGAGCCTTCGGAAAACGAGAAAAGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAAAGAACAGCTGGCTGCCCTGAGGAAACACCATGAAGATGAGATTGACCACCATTCGAAGGAGATAGAGCGTCTGCAGAAGCAAATTGAACGCCATAAGAAGAAGATCCAACAACTAAAGAATAATCATTGAATGCGCGCAGTCGGTCCCTCACAGAGTG

Ensembl | nº de acceso | ratón

ENSMUSG00000054428

Nº de acceso NCBI

NM_007512

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ATPIF1(11983) , Atpif1(11983)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition
Fabrice Ivanes et al.
British journal of pharmacology, 171(18), 4193-4206 (2014-03-20)
Ischaemia compromises mitochondrial respiration. Consequently, the mitochondrial F1 Fo-ATPsynthase reverses and acts as a proton-pumping ATPase, so maintaining the mitochondrial membrane potential (ΔΨm ), while accelerating ATP depletion and cell death. Here we have looked for a molecule that can

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico