Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU045141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGGTGTGGGTCAGGAAATCACATCTTATACCGCTCGAGAGCCGGACACGTTCATGGATCAGAAGATCACGTATCGGATTTGGAGGGACACTGCCAACTGGCTGGAGATTAACCCAGAGACTGGTGCCATTTTCACGCGCGCTGAGATGGACAGAGAAGACGCTGAGCATGTGAAGAACAGCACATATGTAGCTCTCATCATCGCCACAGATGATGGTTCACCCATTGCCACTGGCACGGGCACTCTTCTCCTGGTCCTGTTAGACGTCAATGACAACGCTCCCATCCCAGAACCTCGAAACATGCAGTTCTGCCAGAGGAACCCACAGCCTCATATCATCACCATCTTGGATCCAGACCTTCCCCCCAACACGTCCCCCTTTACTGCTGAGCTAACCCATGGGGCCAGCGTCAACTGGACCATTGAGTATAATGACGCAGCTCAAGAATCTCTCATTTTGCAACCAAGAAAGGACTTAGAGATTGGCGAATACAAAATCCATCTCAAGCTCGCGGATAACCAGAACAAAGACCAGGTGACCACGTTGGACGTCCATGTGTGTGACTGTGAAGGGACGGTCAAC

Ensembl | nº de acceso | ratón

ENSMUSG00000000303

Nº de acceso NCBI

NM_009864

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CDH1(12550) , Cdh1(12550)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Chunyan Zhao et al.
Cancer research, 74(14), 3983-3994 (2014-05-17)
Triple-negative breast cancer (TNBC) is an aggressive clinical subtype accounting for up to 20% of all breast cancers, but its malignant determinants remain largely undefined. Here, we show that in TNBC the overexpression of Fra-1, a component of the transcription

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico