Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU044061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ctcf

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGGCAGAGCATTCAGAACAGTGACCCTCCTGAGGAATCATCTGAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCGATATGGCCTTTGTGACCAGTGGAGAATTGGTGCGGCATCGTCGTTATAAACACACTCATGAGAAACCATTTAAGTGTTCCATGTGTGATTATGCCAGTGTAGAAGTCAGCAAATTAAAACGACACATTCGCTCTCATACTGGAGAGCGCCCGTTCCAGTGCAGTTTGTGCAGTTATGCCAGCAGGGACACATACAAGCTGAAAAGGCATATGAGAACCCATTCAGGGGAAAAACCTTATGAATGTTATATTTGTCACGCTCGGTTTACCCAGAGTGGTACCATGAAGATGCACATTTTACAGAAGCACACAGAAAATGTGGCCAAATTTCATTGTCCCCATTGTGACACTGTCATAGCCCGAAAAAGTGATTTGGGTGTCCACTTGCGAAAGCAGCATTCCTATATTGAACAGGGCAAAAAATGTCGCTACTGTGATGCTGTGTTTCATGAGCGATATGCTCTCATCCAGCA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Francisco Puerta Martínez et al.
Journal of virology, 88(13), 7389-7401 (2014-04-18)
Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA
Robert J Lake et al.
PLoS genetics, 10(3), e1004204-e1004204 (2014-03-08)
Mechanisms that maintain transcriptional memory through cell division are important to maintain cell identity, and sequence-specific transcription factors that remain associated with mitotic chromatin are emerging as key players in transcriptional memory propagation. Here, we show that the major transcriptional

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico